The Secrets of Cancer Cells

Scientists have begun to learn what causes a tumor to grow, but how to stop that growth remains a mystery

BY ROBERT A. WEINBERG

OVER THE PAST SEVERAL YEARS, THE NEW TECHniques of biotechnology have touched one of the most recalcitrant problems in human health: cancer. Using these techniques, scientists have learned far more about the disease’s origins and nature than could have been stated with any confidence even a few years ago. Those who follow the news about these advances may assume that cancer cures are imminent. Unfortunately, although present knowledge may point research in the direction of potential cures, major advances, with some exceptions, are still years away. A review of what has been learned, and where the discoveries might lead, should make clear how far the research still has to go.

In trying to trace the origins of cancer, one must first outline the disease’s effects on large populations. Let us begin by asking a topical question: Is the industrialized world threatened by an ever-rising tide of cancer? The fact that the number of deaths as a result of cancer rose from 107.1 per 100,000 Americans in 1933 to 179.6 in 1979 would suggest that this is the case.

Some of the increase can be explained by one simple fact: cancer is in large part an affliction of the old. Although many exceptions to this rule exist—childhood leukemia, for example—the great majority of people who die from the disease are those who have lived beyond their middle years: those who if they did not die of cancer would soon be lost to other ailments, such as circulatory disorders. Wiping out cancer would increase the average lifespan in the U.S. by only two years beyond the present seventy-four. Once one realizes that cancer is largely a gerontological phenomenon, it becomes clear why doctors diagnose more new cases each year. Cancer is increasing in frequency because more people are living long enough to contract the disease. Fifty or a hundred years ago, few reached the late age at which cancer becomes common. Cancer was not a threat to people lying on their deathbeds at the age of twenty-five, put there by tuberculosis, pneumonia, or childbed fever.

Because longevity is increasing steadily, adding up the number of cancer deaths year by year and comparing the totals is a meaningless exercise. The only interpretable statistic is one that compensates for the population’s lengthening average lifespan. Age-adjusted statistics allow one to ask: What chance does the average sixty-yearold man or woman have of dying of cancer now? By comparison, what was the risk for sixty-year-olds fifty years ago?

Even when one makes this adjustment, the numbers are depressing. The cancer death rate still appears to have increased substantially, from 143 per 100,000 people in 1930 to 170 in 1979. Yet another level of statistical sophistication exists, however. One can analyze the population not only according to age but also according to habits, distinguishing those who use tobacco from those who abstain. Once this is done, almost the entire increase in the cancer rate is accounted for by smokers. The number of deaths from respiratory-tract cancer (contracted chiefly by smokers) rose from four per 100,000 in 1930 to forty-four in 1979—an increase of 1,000 percent; the death rate from other cancers actually declined somewhat over the same period. If smoking were eliminated tomorrow, deaths from cancer would decline by 30 percent over the next generation. With minor exceptions, the incidence of cancer among nonsmokers is about equal to the rates observed for this group thirty, forty, and fifty years ago. This constancy is reassuring: it proves that non-smokers are not in the grip of an epidemic of cancer.

The rapidly increasing cancer rate among smokers suggests something else—something that few people only a generation ago realized: cancer, unlike sagging skin and a collapsing spine, is not an inevitable consequence of growing old. The disease is not programmed into the aging process. Instead, most forms are caused by exposure to substances brought into the body via food or tobacco. Cancer comes from insults to the body that in the best of worlds could be avoided.

Although smoking can explain the causes of most respiratory-tract cancers, it cannot be invoked to explain the causes of dozens of other cancers, such as breast and colon tumors. Since the incidence of these other cancers has remained largely stable over the past fifty years, their causes—whatever they may be—cannot have changed much. If those of us in research could only determine the causes of these other cancers, in the same way that we have determined the cause of most lung cancers, then perhaps the best of worlds would become less elusive.

One can isolate potential causes of many cancers by studying the incidence of disease around the world; cancer occurs at dramatically different rates in different geographical locations. Stomach cancer strikes six times more frequently in Japan than in the United States. In West Africa, colon cancer is about ten times less common than in the U.S. We can conclude at least tentatively that environment creates drastic differences in risk.

Some might question this hypothesis by suggesting an alternative explanation: that Japanese or West Africans have special, genetically determined susceptibilities. The facts do not support this suspicion, however. Americans of Japanese descent enjoy low stomach-cancer rates. And American blacks, who are genetically close to West Africans, suffer colon cancer at rates greater than those for the rest of the U.S. population. Such evidence rules out genetic susceptibilities as an explanation of these greatly different rates, and makes environmental exposure the only reasonable interpretation.

This logic can be taken a step further. If colon cancer is ten times more frequent in the U.S. than in West Africa, then at least 90 percent of colon tumors here would be avoided if the American environment could be made identical to the West African environment. By extension, one might ask: How would cancer rates change here if the American environment could be altered to achieve both the low colon-cancer risk of West Africa and, say, the low cervical-cancer risk of Israel? When the lowest rates of various cancers worldwide are listed together, it becomes clear that if the American environment were ideal, more than 85 percent of all cancers could be avoided.

What do the environments of West Africa and Japan offer that make cancer rates there so different from those in the U.S.? Diet emerges as the chief environmental factor in many of the cancers that are not caused by smoking. Epidemiologists have identified a number of dietary elements whose role in inducing cancer is gaining increasing acceptance. The one most widely cited is fat. Country-bycountry comparisons show strong correlations between fat intake and the incidence of colon and breast cancer; those whose diets are high in fat succumb with greatly increased frequency to these diseases. A diet rich in red meat also seems to correlate well with cancer of the colon. In Japan, where dietary habits have become Westernized since World War II, the rates of colon and breast cancer are climbing to Western levels. At the same time, the longstanding Japanese preference for pickled, smoked, and fermented foods seems to be related to the country’s traditionally high rate of stomach cancer.

These correlations do not constitute rigorous scientificproof of a cause-and-effect relationship between diet and disease. Nonetheless, they are so persuasive that last year a panel on diet and cancer convened by the National Academy of Sciences recommended a drastic shift in American dietary habits. The panel suggested a prudent, but hardly Spartan, diet, much lower in fats and oils, and higher in green vegetables, fruits, and grains, which appear to protect against certain types of cancer.

Environmental pollutants are conspicuously absent in the lists of factors that coincide with frequently occurring cancers. Many tumors common in industrial countries prove to be just as common in non-industrial countries, such as New Zealand, Iceland, and Finland. However, no one can rule out the possibility that, at some point in the future, the rates of certain cancers will rise dramatically, once populations have been exposed to industrial carcinogens for a sufficient period. Bombs could well be ticking away under our feet. Some, for that matter, have already gone off here and there, creating epidemics in small, discrete populations: for example, among workers who, having been exposed to various chemicals, are succumbing to bladder cancer, and among asbestos workers, who show high rates of an unusual tumor called mesothelioma, which appears in the chest or abdomen. Although such tumors are real and frightening prospects for those few at risk, they have not made much of a difference yet in the gross number of cancer deaths.

THE IDENTIFICATION OF CARCINOGENS MAY HELP people to minimize their chances of contracting cancer, but it does not begin to solve the underlying puzzle: How do carcinogens cause cancer? Biologists know much more about this now than they did even a year ago. The advances rest on a body of work begun in a period that most biology students consider prehistoric. Early in this century, X-rays were found to be carcinogenic. Then, in the late 1920s, X-rays were discovered to cause changes in the hereditary patterns of fruit flies. From these two seemingly unconnected facts came an important hypothesis, which was widely held but based, until recently, only on circumstantial evidence: Agents that cause cancer are agents that damage (mutate) the genetic material. Carcinogens induce cancer because they are “mutagens”— that is, they are capable of mutating genes. This hypothesis suggested that the target of carcinogens is deoxyribonucleic acid, or DNA—the complex molecule in the cells of all living organisms whose segments, or genes, serve as the carriers of information for biological functions.

An important piece of evidence supporting this idea emerged twenty years ago, when researchers traced the path of carcinogens introduced into rodents. The carcinogens entered the cells of various tissues, and proceeded to bind tightly to the DNA. Significantly, strong carcinogens—chemicals that most often provoked tumors— bound more avidly to DNA than did weak carcinogens.

A further clue to the action of carcinogens came from an unexpected quarter outside the mainstream of cancer research—from studies of the hereditary patterns of bacteria. There are strong analogies between human and bacterial cells, because all cells are built on the same basic plan. They run on the same machinery, and depend on the same substance—DNA—to direct the machinery. Thus, the DNA of bacteria can serve as an excellent model for human DNA. Moreover, bacteria are a pleasure to work with. They reproduce themselves as often as every twenty minutes. In a simple and cheap overnight experiment, a researcher can study the DNA and heredity of a trait distributed through a population of hundreds of millions of bacteria. In contrast, cells taken from a human body are difficult to manipulate: they grow slowly, are expensive to feed, and succumb to the slightest alteration in their environment.

Several experimenters reasoned that the DNA of bacteria should behave like human DNA when confronted with carcinogens. Of course, bacteria do not contract cancer. How, then, could the effects of carcinogens be monitored? A simple solution evolved: study instead the ability of carcinogens to alter bacterial genes controlling metabolism— genes that tell a bacterium how to break down certain nutritive compounds. This strategy, initiated by several groups, was developed most extensively by Bruce Ames, a professor of biochemistry at the University of California at Berkeley.

Ames gathered a large, motley group of chemicals: petrochemical products, hair dyes, natural biochemicals, and so forth. He exposed bacteria, and thus their genes, to these chemicals, and waited—though not for long, of course, since bacteria respond quickly to stimuli. Ames confirmed what others before him had found—that certain compounds readily alter bacterial genes. These powerful mutagens cause genetic damage when present in only trace amounts. Ames found weak mutagens, as well; the DNA-damaging properties of these compounds became apparent only when they were present in high concentrations. Most exciting, Ames found that the compounds wreaking genetic havoc in bacteria were the same ones that had been found to cause cancer in the experiments with rodents. Conversely, the compounds that reacted only weakly with Ames’s bacterial genes had behaved as weak carcinogens in animals. Such data came close to proving the hypothesis that mutagens are almost invariably carcinogens. This relationship has since emerged as a fundamental tenet of cancer research.

As a result of the work with rodents and bacteria, the perception of carcinogens has changed. Scientists no longer think of carcinogens as chemicals that exist specifically to cause cancer. Instead, carcinogens are understood to be compounds that happen to be particularly adept at damaging DNA, thereby creating mutations in genes. Human cells exposed to carcinogens accumulate damaged genes. Cancer emerges as only one of several random consequences of the gene damage. Carcinogens do not seek out favored genetic targets for special attention. Instead, after entering tissue, the invading molecules strike at many constituents of the cells. On rare occasions, a carcinogen molecule may encounter a critical target—a segment of DNA—and a deadly train of events is set in motion.

All this points to a simple pathway of carcinogenesis. Substances enter the body largely via the lungs or gut. These substances interact with the DNA present in the cells of certain tissues. By altering the structure of DNA, they create new genetic configurations that trigger the growth of tumor cells.

There are dangers in accepting a scheme as simple as this. Complicating facts intrude upon its clarity. Take, for example, the substances implicated as carcinogens. When they enter the body, most are relatively inert, and lack any ability to damage DNA. But once inside a cell, these potential carcinogens are altered—activated by the cell’s metabolic processes. At this point they readily attack, and combine with, vulnerable molecules in the cell. (Ironically, this metabolic activation of carcinogens depends on enzymes that exist to detoxify dangerous compounds. Enzymes that have evolved to shelter the body from chemical attack can inadvertently create novel and dangerous compounds.) Some researchers think that people’s varying susceptibility to cancer may be explained in part by individual differences in metabolism. Certain people may activate carcinogens more readily than others. They may carry around especially powerful activating enzymes in their livers and lungs, and may, as a consequence, run special risks when confronted with potential carcinogens.

This problem of metabolic activation is only one of several complications in the attempts to discover the steps that lead to cancer. The greatest obstacle has to do with the DNA itself. Thirty years ago, James Watson and Sir Francis Crick unveiled DNA’s double-helix form. Today, freshman students of biology learn the elegant simplicity of this structure. The problem with DNA arises not from its structure but from the staggering amount of information that a DNA molecule carries.

Each of the two intertwined strands of the DNA double helix forms a long polymer—an extended, end-to-end aggregate of chemical bases. There are four different kinds of bases, and their sequence in the strand composes information in the same way that the ordering of written characters composes words. The DNA double helix in a single bacterial cell carries the blueprint for building the bacterium. The strands of DNA in a single human cell, which are one thousand times longer, carry the information for forming the entire human body; they consist of 6 billion bases, strung out end to end. In fact, the DNA in a human cell holds much more information than is required for a complete blueprint. Human beings carry around information that has accumulated over 3 billion years of evolution, much of it apparently unused—the artifacts of geneticevents millions of years in the past. Information layered upon information. A mixture of the truly important and the utterly useless. An endless complexity. The magnitude of the puzzle now becomes apparent.

If activated carcinogens mutate DNA by altering the sequence of bases, then which of these many sequences must be changed in order for cancer to begin? One answer would be that a change in sequence occurring anywhere in the DNA will lead to cancer. But such an answer ignores simple realities. Many DNA sequences are meaningless relics; changing these sequences would have no effect. Other sequences of DNA bases carry information on important functions of the organism. Certain such sequence units encode information for eye color or hair curliness; others specify biochemical reactions in the cell. The special functions of these sequences do not seem to be connected with the phenomenon of cancer. After all, cancer is an aberration of growth—not of eye color or hair texture.

And there may lie a clue. Of all the myriad sequences in human DNA, those few that control normal, healthy growth could be the critically important targets. Perhaps they become redirected by mutation into programming abnormal growth, which is often tantamount to cancer.

This is a simple model, and perhaps even a correct one. But how to confirm it? The real problem, momentarily forgotten, returns to frustrate us: these hypothetical growthcontrolling sequences, seemingly important for understanding cancer, can make up only a minute fraction of all the DNA sequences in the cancer cell. The rest of the sequences in the cell—the vast majority—reveal nothing about the cancer process. Somewhere in the 6 billion bases of the cancer cell, something has gone drastically awry. A critical control sequence has been meddled with, but how to find it?

THE GORDIAN KNOT WAS CUT IN THE PAST YEAR, AND not by any modern-day Alexander. Instead, biotechnology arrived on the scene. The techniques of “gene cloning” are ideally suited for solving the problem at hand, because they enable researchers to fish out a small genetic segment from the vast pool of unrelated sequences. (“Cloning” refers to the purification of a gene so that it emerges uncontaminated by the thousands of other genes present in DNA.) After a gene has been isolated and cloned, it can be amplified to hundreds of millions of copies in properly prepared bacteria. Having many copies of a single gene simplifies analysis enormously.

Different genes are cloned every day: among others, those that specify insulin, the blood protein hemoglobin, connective-tissue protein, and interferon have been identified. Eventually, someone will likely clone the gene that specifies eye color or hair curliness. A recipe book for cloning genes was published just last year. Few genes, once pursued by the gene cloners, can elude capture.

Cancer cells have also yielded an important part of their mystery to these powerful techniques. The cloners have extracted from cancer cells those few genes that force cells to grow abnormally. Researchers call these growth-controlling sequences in cancer cells “oncogenes.” Cloning has made it possible for researchers to retrieve oncogenes from carcinomas of the bladder, lungs, and colon, as well as from leukemias. The most thoroughly studied oncogene in human cells comes from a human bladder carcinoma. Six thousand bases, strung end to end, make up this oncogene. (Its complexity may seem intimidating, but one should bear in mind that the DNA of the tumor cell as a whole has 6 billion bases.) By studying the cloned oncogene, scientists have learned the answer to an intriguing question: How does a tumor cell acquire an oncogene? Molecular analysis of a cloned oncogene points to a simple solution. The malignant gene arises as a slightly altered version of a normal cellular gene. This normal gene, whose precise function remains obscure, is the critical target in the cell’s DNA; when it is transformed into an oncogene, it assumes the role of a master control and soon dominates cellular behavior. It forces the cell to shift gears. The cell loses touch with its normal priorities, which tolerate growth only when appropriate, and is forced into endless growth. By growing and dividing, the cell spawns the billions of descendants that form a tumor mass.

In recent months, the steps by which a normal gene becomes mutated into an oncogene have been explained. The change is extraordinarily subtle. Experiments have compared an oncogene of a bladder carcinoma with its normal antecedent. Since all genes are arrays of base sequences, comparison of the two genes demanded precise mapping of the sequences constituting the two genes.

These days, experimenters can puzzle out the base sequence of a cloned gene in several months’ time. The four bases—A, C, G, and T (the letters represent the four different chemical bases)—are arranged in a special and meaningful order from the beginning to the end of each gene. By deciphering the sequence, one discovers the gene’s structure. Such a sequence might read like this: AGGCCTAAGCCCTAGAGCCC, continuing on for a total of 6,000 bases in the case of both the oncogene and its normal counterpart. Experimental tricks made it possible for researchers to focus attention on limited areas of the two genes—on limited portions of each sequence. When the critical sequences of the oncogene and the normal gene were read out, the results were astounding. The differences between the two almost disappeared. A single base distinguished the oncogene from its normal precursor: one base out of 6,000. Change one critical base out of the 6,000 bases of the normal gene, and you get an oncogene. Change one critical base out of the 6 billion in the cell’s DNA, and you push the cell down the long slide toward cancer.

This difference is so subtle, so minute, that it defies credibility. How can such a tiny change in a gene have such shattering consequences for a cell, and subsequently for an organism? There are precedents, the most well known of which is sickle-cell anemia, a hereditary disease afflicting blacks. Those who suffer from this disease carry defective copies of the genes that serve as templates for blood hemoglobin. The defect here, as in bladder cancer, can be traced back to a single base. In the case of sickle-cell anemia, the altered gene causes defective hemoglobin to be produced, and devastating circulatory problems ensue.

One circle in this description can be closed now by tying together carcinogens and oncogenes. Let us begin with circumstances and behavior that bring into the human body a variety of chemicals, both natural and man-made. Metabolic alteration of these compounds leads to their activation in various organs. In turn, the activated compounds begin their attack on the DNA, striking at sequences randomly. One molecule of a carcinogen has only a small chance of hitting a critical sequence. But patient repetition succeeds where a single rash attempt fails. After years of flooding a smoker’s bladder, after millions of forays, the carcinogens will succeed: an active carcinogen molecule will hit a vulnerable chink in a critical gene. This hit creates a mutation, and causes the altered gene to assume the role of an oncogene. The newly created oncogene now issues directives, forcing a compliant cell to grow and divide when and where this cell should, by all rights, remain inactive.

One can blame carcinogens for many disasters leading to oncogenes, but not for all of them. On occasion, the human body may create oncogenes in its cells without external provocation. Cells can inadvertently mutate their own DNA. A striking example of this came to light only a few months ago. Researchers have known for some years that certain bone-marrow cells rearrange a special set of genes in preparation for mounting a normal immune response. They have just learned that on rare occasions, the process goes awry, and brings about a bizarre rearrangement of genes. This in turn creates an oncogene. Cancers like childhood leukemias, which have few apparent environmental sources, may result from these internal mistakes— mistakes that can occur in anyone, even a person living virtuously in an ideal environment. It is indeed a wonder that such mistakes do not happen more often.

THE CANCER CELL IS NO LONGER AN IMPENETRABLE black box. Exactly what goes wrong when the cell undergoes its malignant transformation is becoming apparent. More important, scientists know where to look for solutions to the remaining puzzles. Crucial puzzles still exist. Here are two of the big ones. It will take another decade to work these out.

First. Why does it take so long for cancer to occur? It does take a very long time. Lung cancer offers a most instructive lesson. In the next several years, a watershed in medical history will be reached: more American women will die from lung cancer than from breast cancer. The female lung-cancer epidemic can be traced back to its roots—to a point thirty years ago when it became acceptable, even fashionable, for women to smoke. A generation later, the innovators of social convention are dying left and right.

Why does it take so long—thirty years of continued abuse—for tumors to appear? Some delay may come from the difficulty that a carcinogen has in meeting with and mutating the proper gene. But further answers are needed. Even after an oncogene becomes activated, other changes must occur in the cell before it can become a competent tumor cell. Scientists suspect that at least one and perhaps several other altered genes must cooperate with the oncogene to achieve the end result. Perhaps a relatively rare event like a mutation must occur to turn on each of these other genes. Cancer seems to depend on a succession of rare events taking place over many years. A cancer found today is likely to have been caused by a series of these events that began in the body ten, twenty, or thirty years ago. Activating an oncogene seems to be one of these events. The nature of the other events is yet to be discovered.

Some of the steps leading to cancer seem to depend on chemicals, known as “promoters,” that do not mutate DNA. They are known to aid the carcinogenic process by somehow pushing a cell further down the road toward cancer, cooperating with mutagens even though they do no damage to DNA by themselves. Asbestos may function as a promoter. While it is unable to damage DNA directly, it seems greatly to increase the risk of mesothelioma, usually by cooperating with cigarette smoke.

Not that cigarette smoke needs much help. It is thick with mutagens and even thicker with promoters. Both kinds of molecules are to be avoided. And therein lies a quandary for the guardians of public health. One can test for mutagens rather easily. Thanks to Ames and his bacteria, cheap and simple methods for detecting mutagenic compounds in the air, in tobacco smoke, and in charcoaled meat are available. But the promoters are more insidious. There is no simple way to test for them, because they do not mutate DNA. All one can do is apply them to test animals—a long, expensive, and frequently unrewarding exercise. How can promoters in the environment be controlled if it is so hard even to identify them? How important are they in the long, drawn-out process of human carcinogenesis?

Second. How does an oncogene force a normal cell to behave abnormally? The tumor cell carries 50,000 or more genes, and yet one of them, the oncogene, dominates behavior. How can one gene assume such influence in subverting cellular behavior? Most answers to this question are still wildly speculative.

The clues that exist are vague and not terribly useful. One speculates that because the oncogene induces runaway growth, the normal version of the gene must regulate normal growth. A lot is known already about the way in which a normal cell is put together and about how many normal genes work. One day soon, how the normal, growth-regulating genes work, and by implication, how their tainted versions disrupt the delicate normal balance between quiescence and growth, will also become clear.

This is an exciting prospect, and not just for cell biologists. Understanding the way oncogenes work could provide a basis for developing a rational treatment of cancer. Once scientists understand the master control switches, they may be able to trip them back and limit the growth of cancer cells.

At the moment, cancer is treated in three basic ways: surgery, radiotherapy, and chemotherapy. These approaches in concert cure a substantial number of previously untreatable cases. For example, more than half of the patients afflicted with the most common kind of childhood leukemia are cured when the disease is diagnosed early. But many adult tumors, lung cancer among them, are largely unresponsive; treatment at best postpones the inevitable. New ways to kill cancer cells must be found. The existing chemotherapeutic drugs are rather ineffective at counteracting most types of solid tumors. These drugs are more lethal to cancer cells than to normal cells, but they aren’t selective enough.

The design of selective drugs has been elusive, because until recently, the essential differences between normal cells and cancer cells have not been understood. A truly selective drug would take advantage of such a difference, and kill only the flawed cells. Because the presence of an oncogene has been identified as an essential flaw in a cancer cell, ways of antagonizing the workings of an oncogene can begin to be studied. It is now possible to think of ways to design drugs that could kill cancer cells selectively, or return them to normal.

SELECTIVE DRUGS ARE NOT AROUND THE CORNER. Their development will likely take a decade or more. And that brings us to another important point: the recent leaps forward reveal a lot about the causes of cancer, but they have not yet revealed any specific cures. This fact bears implications for public policy.

For the next decade, and likely beyond, the big reductions in cancer deaths will come from preventing cancer, not from treating it. A smoker indulges in self-delusion if he thinks that medicine will rescue him from lung cancer ten years from now. The only effective way to reduce the number of deaths from lung cancer will be to reduce the number of smokers. Similarly, a substantia] decline in the number of deaths from colon and breast cancer will likely come from changes in diet, perhaps involving a shift in the American diet away from fat.

History offers precedents for this prediction. The enormous drop in the number of deaths from infectious diseases had little to do with antibiotic treatment. Instead, it was learned early in the nineteenth century that filth is unhealthful. Public sanitation led to great increases in lifespan a century before antibiotics appeared on the scene. Similarly, the fourfold decline in deaths from stomach cancer in the U.S. over the past fifty years can in no way be credited to improvements in treatment. Stomach cancer is as lethal now as it was in earlier times, but fewer people contract it, most likely because fewer people are exposed to its causes. Perhaps improvements in food storage, such as refrigerators and the much-maligned food preservatives, are responsible. Here again, avoidance has succeeded where treatment has failed.

The recent, very real advances in biology reveal much not only about cancer but also about how to organize scientific research. Or, perhaps, how not to. The origins of some of these recent advances are edifying. How was the Ames test for carcinogens developed? How did scientists come to isolate and dissect oncogenes? Some may find the answer startling. These advances depended on areas of work totally unrelated to cancer: results from laboratories involved in studying the sexuality and genetics of bacteria.

There are many such examples, but the point is already well made. Cancer research has continually reaped the harvest of other areas of experimentation—molecular and cellular biology, biophysics, microbial genetics, and so on. For years, agencies such as the National Cancer Institute and the American Cancer Society have been supporting work in areas ostensibly outside their purview, because of a belief—almost a religious conviction—that basic, nongoal-oriented research would pay off in the end. These and other granting agencies have given license to many biologists to do what interests them, so long as they do it well. Some of the researchers have done very well, and much of the investment has been paid back, in ways that nobody dreamed of.

One might conclude that the scientific understanding of cancer has progressed so far that non-goal-oriented studies can be safely abandoned. The history of cancer research proves that such a policy would be a serious mistake. Imagine a scenario very different from that of the past two decades. Imagine that twenty years ago, the funding agencies decided that the best way to understand cancer was to support only those projects whose goals were to answerspecific questions about human cancer. The impact of such a policy on science today should be clear. Scientists would not have the Ames test or know about oncogenes. They would not have developed gene cloning and used the technique to produce cheap insulin and interferon. They would not have come so close to a full understanding of cancer, and, perhaps, further off, its cures.